Thursday, 21 July 2011

Yahoo! Answers: Latest Questions

Yahoo! Answers: Latest Questions

[ History ] Open Question : What kind of organization is PETA?

Posted: 21 Jul 2011 09:04 PM PDT

[ Polls & Surveys ] Open Question : Poll: Which cartoon character do you think has the weirdest name?

Posted: 21 Jul 2011 09:04 PM PDT

[ Maintenance & Repairs ] Open Question : Can I put wd-40 on rusty battery terminal!?

Posted: 21 Jul 2011 09:04 PM PDT

[ Video & Online Games ] Open Question : How do i use a walmart visa card for stardoll membership?

Posted: 21 Jul 2011 09:03 PM PDT

help please?

[ Teen & Preteen ] Open Question : I love my boyfriend! Whats your first impression on him?

Posted: 21 Jul 2011 09:03 PM PDT

http://www.google.ca/imgres?q=justin+bieber+never+say+never+premiere&um=1&hl=en&sa=N&rls=com.microsoft:en-CA:IE-Address&rlz=1I7ACAW_enCA359CA359&biw=983&bih=576&tbm=isch&tbnid=PcNDkOVmy_ZRwM:&imgrefurl=http://connect.in.com/justin-bieber-email/photos-1-1-1-9fe1ed6c2f2e269c7c2af231b22acc39.html&docid=pSD-InamLj4CmM&w=783&h=1024&ei=J_YoTtTSCPC40AHOyPTYCg&zoom=1&iact=rc&dur=234&page=7&tbnh=174&tbnw=133&start=81&ndsp=10&ved=1t:429,r:5,s:81&tx=122&ty=92

[ Cell Phones & Plans ] Open Question : Can I replace my cell phone?

Posted: 21 Jul 2011 09:03 PM PDT

I got a Samsung Jack back in May. Yet the phone has a horribly slow processor and doesn't properly send my messages. I have insurance, and I'd like to replace it. But they no longer make the Jack? What will they do if I go to the AT&T store. Also my upgrade is in like two years.

[ Hair ] Open Question : How do I cut my hair like Christina Grimmie's?

Posted: 21 Jul 2011 09:03 PM PDT

I want to get my hair cut. My hair is down to my mid-chest, and I have some layers in it but not many, and not as short as Grimmie's layers and not as many as she has. I cut my own layers, where I put the hair in a pony tail and cut it straight, but I'm afraid if I try to cut my layers more they will look terrible. I want my hair to look like this: http://img2.timeinc.net/ew/i/2011/07/08/Christina-Grimmie_240.jpg http://img2.uploadhouse.com/fileuploads/10586/105864320bb6aeb7bab16ad9d7d9425a8b1bda27.jpg I want a little more than she has, long hair on the bottom. But I think this is incredibly cute and I'd love to have this. How would I cut my hair like this myself? All information you have is appreciated (:

[ Biology ] Open Question : how can i transcribe and translate the following dna sequence?

Posted: 21 Jul 2011 09:03 PM PDT

2.Based on the DNA sequence below, transcribe and translate the message with the assumption that the first "A" is the start of transcription. Find the appropriate start and translate. (4 pts) 5'…AGCTTATGCAGGACTTACTATGCTAAGGCCCTGAGAGTAGTTAGCTA 3' 5'…AGCTTATGCAGGACTTACTATGCTAAGGCCCTGAG AGTAGTTAGCTA…3'

[ Drama ] Open Question : who is going to watch this season of Jersey Shore?

Posted: 21 Jul 2011 09:03 PM PDT

I AM I CAN'T WAIT!

[ Jokes & Riddles ] Open Question : riddles . Please use at least 20 characters.?

Posted: 21 Jul 2011 09:03 PM PDT

can you answer these riddles?? Four men were in a boat on the lake. The boat turns over, and all four men sink to the bottom of the lake, yet not a single man got wet! Why? What can run but never walks, has a mouth but never talks, has a head but never weeps, has a bed but never sleeps? What gets wetter the more it dries?

[ Languages ] Open Question : someone please help me. what should i do?

Posted: 21 Jul 2011 09:03 PM PDT

so..this guy is really mean to my best friend. and she doesnt deserve. i need some quotes or something to say to her to cheer her up. like saying she deserves better. thank youu!! :)

[ Software ] Open Question : How much would you pay for a used 2008 Macbook?

Posted: 21 Jul 2011 09:03 PM PDT

How much would you pay for a late 2008 aluminum macbook. Specs : 2.4 GHz 250 GB HD 2GB RAM Backlit keyboard 13 inch screen iLife 2011 apparently in good shape. Im being offered 640 for the laptop and will buy it on saturday. Fair price? look for something better? Will this laptop help me for my freshman year in college?

[ Rap and Hip-Hop ] Open Question : What Nicki Minaj song is this?

Posted: 21 Jul 2011 09:03 PM PDT

Ok so all I remember from this song is a guy who sounds like one of the guys from black eyes peas or something singing Oh 3x and then Nicki comes after going be dum bum 3x. Please help me out.

[ Horses ] Open Question : Do Bruno Delgrange saddles feel smaller than other saddles?

Posted: 21 Jul 2011 09:03 PM PDT

I read an article that stated that Delgrange saddles feel a half size smaller so you should buy a saddle a half seat larger to make it feel normal. Can I get any opinions on this? Please and Thank you!

[ Men's Health ] Open Question : Have I hit any growth spurt yet?

Posted: 21 Jul 2011 09:03 PM PDT

I am 13 5'8 at 12 i was 5'3 my mom 5'7 dad 5'10 will I grow more

[ Polls & Surveys ] Open Question : would it annoy you to rarely be home alone?

Posted: 21 Jul 2011 09:03 PM PDT

my sis offered to let me stay at her place during an internship i've started this summer. i love being here, but there's always someone home. so whenever i get home from work, i don't get peace and quiet, unless i go to my room. but i like the kind of peace and quiet where the whole house is calm and i can just be with my thoughts. i always like to just chill after work for a little bit. she has a nanny everyday who stays here till the kids are asleep, two housekeepers (they're not here on the same days though), and a tutor who comes almost every morning. would this annoy you to not have privacy? i feel like whenever i am home alone (which is rare) that it's a treat for me.

[ Polls & Surveys ] Open Question : Guys: Do you want to be a gentlemen?

Posted: 21 Jul 2011 09:03 PM PDT

I only act like one to be honest. Personally i dont really enjoy paying for them, opening car doors, or treating them like a Princess. I want to date a women, not my 2yr old daughter. But thats just me.

[ Video & Online Games ] Open Question : What happens if you kill or save Benny in Fallout New Vegas?

Posted: 21 Jul 2011 09:03 PM PDT

I've mostly gone the good path, I got to Mr. House's bunker and uploaded the upgrades from the chip and now I'm looking at Benny. Is it better to let him live or kill him; does he help you or run away again or what?

[ Words & Wordplay ] Open Question : Where can i download dictionaries?

Posted: 21 Jul 2011 09:03 PM PDT

[ Books & Authors ] Open Question : how would you describe this girl in appearance?

Posted: 21 Jul 2011 09:03 PM PDT

Such as: *Hair color + style/length/type/etc *Eye color *Anything else like what would fit for her personality~ -Strange, withdrawn, nearly a shut-in, had a bad life, considered creepy, barely cares about anything, gloomy, cannot function in society, might be mentally ill, rarely speaks, kind of bitter. however she is very smart for her age & also artistic but never shows it. she also has an obsession with disturbing stuff. she always has a droopy/bored/tiered/emotionless expression and generally acts apathetic *might not be a main character though .....and it's slightly based off of me... just a brief description for a character, might use it for a cartoon/comic or something,[nothing serious] i'm not putting every detail here though. idk, just for fun :p female btw.

[ Words & Wordplay ] Open Question : hhghhhhhhhhhhhhhhhhhh?

Posted: 21 Jul 2011 09:03 PM PDT

test

[ Basketball ] Open Question : BUY OR SELL: Lebron gets more pu$$y than Kobe?

Posted: 21 Jul 2011 09:03 PM PDT

over the legal age of course (minors dont count, Kobe)

[ Hair ] Open Question : I need help ! I Bleached my hair an it went all wrong?

Posted: 21 Jul 2011 09:03 PM PDT

I dyed my hair a jet black for 6 months. Im really a light blonde. I bleached my hair an dyed it with a brass be gone. It still has the bass/ red look. Do i bleach it again an then dye it or do i just dye it blonde. I waited a month to do anything to it so i can do anything now.

[ Lyrics ] Open Question : What do you think about my song? It's not finished.?

Posted: 21 Jul 2011 09:03 PM PDT

Every scream. And every fight. It kills me inside. And I don't thunk you realize. How much it hurts. It's like a bullet to the head. And I'm falling into dead. Next time I'm not standing there. While you hit me. I'm not gonna let you do this to me. Because it times for me to leave. I can't stand it anymore. Now I'm walking out the door. You can't hit me anymore. You can't touch me. You can't hurt me.

[ Words & Wordplay ] Open Question : What dumber planking or owling?

Posted: 21 Jul 2011 09:03 PM PDT

I wanna know ur reason random question

[ Quotations ] Open Question : What does this quote mean?

Posted: 21 Jul 2011 09:03 PM PDT

"Before marriage, a girl has to make love to a man to hold him. After marriage, she has to hold him to make love to him." It's by Marilyn Monroe.

[ Google ] Open Question : What is the Best way to Link Exchange in SEO ?

Posted: 21 Jul 2011 09:03 PM PDT

Hi Guys! I am working in SEO company as a SEO executive i know off page SEO clearly. But i don't know how we can Link exchange ? It has become very critical problem for me.. I want to know about this.. Any of you can tell me best way for Link Exchange process..

[ Las Vegas ] Open Question : Is fallout new Vegas dead money worth it?

Posted: 21 Jul 2011 09:03 PM PDT

I have honest hearts and old world blues should I just not buy this and wait for the next one?

[ Insurance ] Open Question : Car insurance Question?

Posted: 21 Jul 2011 09:03 PM PDT

i have L-3-4 and L4-5 Bulging disk in back, an Anterior wedging at T12 Vertebra, Been going to physical therapy since May 10 an my doctor suggest today i go to more physical therapy till end of Aug an get some neck an back shots if things don't get better, I have 6,500 in Med Bills an the other driver is at fault! SO what is a settlement an who will pay the outstanding Med Bills, i have a lawyer how does this work????? Still dealing with a lot of pain

[ Senior Citizens ] Open Question : Have you been living a healthy lifestyle since adolescence and how has that benefit you from your peers?

Posted: 21 Jul 2011 09:03 PM PDT

I am referring to eating healthy and maintaining a good physical fitness regimen

[ Dogs ] Open Question : I have a question about pairing two breeds of dog?

Posted: 21 Jul 2011 09:03 PM PDT

How would pairing a two year old Labrador/Heeler mix with a Welsh Corgi go or fair? Also, do Welsh Corgis shed much? How do they do as far as training go and hows there temperament towards other dogs and in general? Much thanks! I do NOT wish to breed them, my male lab mix is neutered.

[ Singles & Dating ] Open Question : Can a filipina girl ever be trusted ?

Posted: 21 Jul 2011 09:03 PM PDT

ive been with many filipinas over the past few years . i was also serious with 2 of them . all of them seemed genuine at first , but after a few months i came to realise that they are nothing else but compulsive liars who just used me for money . does everyone have the same experience with filipinas ? or is it only my bad luck

[ Words & Wordplay ] Open Question : Is this odd by any chance?

Posted: 21 Jul 2011 09:03 PM PDT

Whenever I read what I write, or type I read it extremely slowly, word after word, figuring out every detail behind the way I write But everything else, I read it extremely fast without looking over it too much I wonder why is this? I try not to, because at times it becomes an annoyance, but my eyes and thought move on it's own I literally tried and it gave me a headache..right now lolz Why is this?

[ Psychology ] Open Question : PLEASE ANSWER! I hallucinate in the dark! I'M SCARED, it's happenin again. ?

Posted: 21 Jul 2011 09:03 PM PDT

Okay, i'm asking this questiong all seriousness. I don't know if it's hallucinating or what.... Okay. Whenever I lay down to go to sleep, I get really paranoid. Like some ones going to come into my room and...whatever. It used to to be so bad (a couple months ago) I would sleep with a baseball bat or lacrosse stick. I don't now, but I have a feeling if I don't calm down I'll do I again. I hve a Swiss knife under my pillow! And when I was really little, I would see things when I tried to sleep all the time. Like floating snake (huge ones like from Harry potter) and this guy that was covered in blood and he looked like a butcher hoovered over my bed with this giant rectangle thing that he would "drop" on me and every time I flinch and jump. Once, this lady like hoovered down from the celing and stole my bear. They haven't happened for like 6 years now, but they're coming back, and they're even scarier now. I'm NOT afraid of the dark either!

[ Other - Pets ] Open Question : how to convince my mom to let me get a guinea pig?

Posted: 21 Jul 2011 09:03 PM PDT

my dad says that guinea pig are extremly nice and cute. my dad says that he will allow me to get a guinea pig if my mom allows me. which makes me nervous because because my mom hates rodents in the house (rabbits,hamsters,gerbils) and when ever i ask her for a animal thats like this she ios always like "NO THEY ARE GROSS" so i need some things to tell her so shell allow me to have one. thx :) ive had my own fish for a few month so by now she should know im responsible

[ Other - Beauty & Style ] Open Question : Where do some girls get their hair extensions?

Posted: 21 Jul 2011 09:03 PM PDT

I mean like clip on extensions that make your hair fuller and longer. Do you find them online? Also what is an average price for them

[ Lyrics ] Open Question : What does adele mean when she says rolling in the deep?

Posted: 21 Jul 2011 09:03 PM PDT

i cant stop listening to that song. but i dont know what she means by that lyric?

[ Tattoos ] Open Question : I want to tattoo myself?

Posted: 21 Jul 2011 09:03 PM PDT

i was planning to use a sewing needle and bust open a crayola washable marker and do that. i wanted a butterfly tattoo on my wrist. im only 13.

[ Singles & Dating ] Open Question : What exactly is he thinking?

Posted: 21 Jul 2011 09:03 PM PDT

This guy liked me in the past and even asked me out (I turned him down) He still liked me up to recently and he says he thinks I'm a good friend and today he texted me this "I want someone who I can just hang out with and have a good time just be myself around and I feel that's you and this is as a friend but like I wanna talk and hang out more and idk just have someone to talk to or to laugh with" What exactly is he thinking? Does he still like me?

[ Weddings ] Open Question : Can anyone answer a few wedding questions?

Posted: 21 Jul 2011 09:03 PM PDT

My fiancé and I are getting married next year and I have only ever been to one wedding before. My wedding is going to be very small about 30 people. It's just going to be a small intimate dinner after the ceremony. Do I need to write two different invites for ceremony and reception if at a different location? And how do I say that the reception is just a small dinner and nothing else like no dancing or do I even add that? And there will be no children invited to dinner to save on money how do I say this? And lastly should I have music at dinner or just conversation? Sorry I know it's alot. Any help is appreciated!

[ Religion & Spirituality ] Open Question : Why couldn't aliens exist if God wanted them to?

Posted: 21 Jul 2011 09:03 PM PDT

I don't understand the assumption that alien life is impossible, just because there's a God. Couldn't God have made aliens? Isn't it a little snobbish and stuck up to say that humans are the only thing important in the universe?

[ Women's Health ] Open Question : Serious question about my body.?

Posted: 21 Jul 2011 09:03 PM PDT

Hey guys, I weight about 240shh and I'm going on a 1,200 calorie diet. I work out five days a week, but with my new meal change... what would happen to my arm flab? I love the feeling of being healthy! what do I do about my arms? will my arm fat go down? Will my arm get skinner? I am taking vitamins :)

[ History ] Open Question : Why was Teddy Roosevelt's grandson doing in Iran?

Posted: 21 Jul 2011 09:03 PM PDT

Why was Teddy Roosevelt's grandson doing in Iran? I tried a resource a book and the internet couldn't find anything to hard or I'm just not looking hard enough. Help? D; full points to the helpful answer

[ R&B & Soul ] Open Question : anyone know a remix for these songs?

Posted: 21 Jul 2011 09:03 PM PDT

today i heard this really good remix of all these songs: -boomerang -born this way -tonight -yeah yeah yeah -hello -give me everything -on the floor -s&m and a couple others, if anyone knows it, or anything similiar, let me know!

[ Buying & Selling ] Open Question : Can a 18 year old get a car loan without co-signer?

Posted: 21 Jul 2011 09:03 PM PDT

I have had the same job for 4 years, I make $1500 a month. I found a car for $8000. Would i be able to get a loan at 18 with no co-signer. I saved $4500 for a down payment!!!!

[ Religion & Spirituality ] Open Question : Prediction please. In what year will the majority of people say "I can't believe all Americans presidents?

Posted: 21 Jul 2011 09:03 PM PDT

had to believe or pretend to believe in God so they could win an election"?

[ Corporations ] Open Question : How can I get hired at a place like starbucks?

Posted: 21 Jul 2011 09:03 PM PDT

Im 17 and I really want to get a job at starbucks, what should I do when I apply

[ Other - Yahoo! Products ] Open Question : Anyone know a website for FREE online tutoring chat rooms?

Posted: 21 Jul 2011 09:03 PM PDT

[ Birds ] Open Question : I can't take my girlfriend's cock?

Posted: 21 Jul 2011 09:03 PM PDT

-atiel. It chirps at all hours of the night. Cheep cheep cheep. It's driving me crazy! What should I do?

[ Cycling ] Open Question : how do people lose sprinters points in le tour de france?

Posted: 21 Jul 2011 09:03 PM PDT

ive noticed in the points classifications that there are tons of cylists with less than 0 points and that cavedish had 320 points after stage 17 but only 300 after 18 (about ten or so others also lost the same amount of points on that stage) and there are about 50 or so with varying minus numbers. How is this possible?
Posted by at

No comments:

Post a Comment

Subscribe to: Post Comments (Atom)